Gateway vectors for efficient artificial gene assembly in vitro and expression in yeast Saccharomyces cerevisiae

Quick Summary:

This paper presents a series of Gateway shuttle vectors for efficient in vitro assembly of artificial genes and their expression in Saccharomyces cerevisiae. The method allows rapid construction of genes using one-step recombination and enables the introduction of assembled genes into yeast for functional testing.

Share: Share on X Share on Facebook Share on LinkedIn

Journal Reference: Giuraniuc CV, MacPherson M, Saka Y (2013) PLoS ONE 8(5): e64419

DOI: 10.1371/journal.pone.0064419

arXiv Id: 1212.5109

Date Published: 2013-05-14

Date Updated: 2013-05-14

Key Terms (TF-IDF):

gene (0.326)

assembly (0.304)

created (0.229)

genetic (0.224)

synthetic (0.211)

vectors (0.185)

artificial (0.178)

expression (0.172)

construction (0.150)

dna (0.144)

recombination (0.136)

bottleneck (0.133)

versatile (0.132)

readily (0.125)

aid (0.123)

time consuming (0.118)

biological (0.117)

encoding (0.117)

consuming (0.117)

valuable (0.116)

License: http://arxiv.org/licenses/nonexclusive-distrib/1.0/

Summary:

Construction of synthetic genetic networks requires the assembly of DNA fragments encoding functional biological parts in a defined order. Yet this may become a time-consuming procedure. To address this technical bottleneck, we have created a series of Gateway shuttle vectors and an integration vector, which facilitate the assembly of artificial genes and their expression in the budding yeast Saccharomyces cerevisiae. Our method enables the rapid construction of an artificial gene from a promoter and an open reading frame (ORF) cassette by one-step recombination reaction in vitro. Furthermore, the plasmid thus created can readily be introduced into yeast cells to test the assembled gene's functionality. As flexible regulatory components of a synthetic genetic network, we also created new versions of the tetracycline-regulated transactivators tTA and rtTA by fusing them to the auxin-inducible degron (AID). Using our gene assembly approach, we made yeast expression vectors of these engineered transactivators, AIDtTA and AIDrtTA and then tested their functions in yeast. We showed that these factors can be regulated by doxycycline and degraded rapidly after addition of auxin to the medium. Taken together, the method for combinatorial gene assembly described here is versatile and would be a valuable tool for yeast synthetic biology.

Citation & Reference Network Visualization

This graph shows how this paper is connected to other research. The current paper is shown in dark gray, papers that cite it are in green, and papers it references are in blue. You can:

Current Paper

Papers citing this work (Citations)

Papers cited by this work (References)

• Hover over any node to see the paper title

• Click a node to view that paper's details

• Drag nodes to rearrange the graph

• Use the zoom controls (bottom right) to zoom in/out

Citations and References

Title	Authors	Year	Actions
Mechanism insights and therapeutic intervention of tumor metastasis: latest developments and perspectives	Xiaoli Shi, Xinyi Wang, Wentao Yao, Dongmin Shi, Xihuan Shao, Zhengqing Lu, Yue Chai, Jinhua Song, Weiwei Tang, Xuehao Wang	2024	View Paper
Measurement of large serine integrase enzymatic characteristics in HEK293 cells reveals variability and influence on downstream reporter expression	George Chao, Clair Travis, George Church	2021	View Paper
Towards the Development of a ϕC31Int-Competent Sf9 Cell Line	Paul Brogee	2018	View Paper
Lighting up yeast cell factories by transcription factor-based biosensors	Vasil D'ambrosio, M. Jensen	2017	View Paper
Short Synthetic Terminators for Assembly of Transcription Units in Vitro and Stable Chromosomal Integration in Yeast S. cerevisiae.	M. MacPherson, Y. Saka	2017	View Paper
Synthetic biology routes to bio-artificial intelligence	D. Nesbeth, A. Zaikin, Y. Saka, M. Carmen Romano, C. Giuraniuc, O. Kanakov, T. Laptyeva	2016	View Paper
Production of farnesene from agro-industrial waste by synthetic biology	David García-Gómez, Silver Ceballos-Valenciano, Karla Valerín-Berrocal, Karol Jiménez-Quesada, Giovanni Garro-Monge	2016	View Paper
A MultiSite Gateway Toolkit for Rapid Cloning of Vertebrate Expression Constructs with Diverse Research Applications	Daniel K. Fowler, Scott Stewart, S. Seredick, J. Eisen, K. Stankunas, P. Washbourne	2016	View Paper
Generation and precise control of dynamic biochemical gradients for cellular assays	Y. Saka, M. MacPherson, C. Giuraniuc	2016	View Paper
Site-specific recombinases: molecular machines for the Genetic Revolution.	F. J. Olorunniji, S. Rosser, W. Stark	2016	View Paper
Correction: Gateway Vectors for Efficient Artificial Gene Assembly In Vitro and Expression in Yeast Saccharomyces cerevisiae		2016	View Paper
New Applications for Phage Integrases	P. Fogg, S. Colloms, S. Rosser, Marshall W. Stark, Margaret C. M. Smith	2014	View Paper
Non‐homologous end joining‐mediated functional marker selection for DNA cloning in the yeast Kluyveromyces marxianus	H. Hoshida, Nobutada Murakami, Ayako Suzuki, Ryoko Tamura, J. Asakawa, B. Abdel-Banat, Sanom Nonklang, Mikiko Nakamura, R. Akada	2014	View Paper
Construction and Assembly of Standardized Biobricks for Synthetic Pathways Engineering in Yeasts	Paulina Korpys-Woźniak, M. Kubiak, M. Borkowska, E. Celińska	2022	View Paper
Biosensor Engineering for the Development of Yeast Cell Factories	Vasil D'ambrosio	2020	View Paper
Complex and Surprising Dynamics in Gene Regulatory Networks	Shangbin Chen, A. Zaikin	2020	View Paper
Supervised learning in synthetic biology : student cells and teacher cells	D. Nesbeth, A. Zaikin, Y. Saka, M. Romano, C. Giuraniuc, Oleg, Kanakov, T. Laptyeva	2016	View Paper
1 Yeast as a Model for Systems Biology Studies on Complex Diseases	J. Castrillo, S. Oliver	2014	View Paper

Title	Authors	Year	Actions
Methods in yeast genetics	D. Burke, D. Dawson, T. Stearns	2013	View Paper
The Elg1 replication factor C-like complex functions in PCNA unloading during DNA replication.	Takashi Kubota, K. Nishimura, Masato T. Kanemaki, A. Donaldson	2013	View Paper
De novo automated design of small RNA circuits for engineering synthetic riboregulation in living cells	G. Rodrigo, Thomas E. Landrain, A. Jaramillo	2012	View Paper
Sequence analysis of a complete 1.66 Mb Prochlorococcus marinus MED4 genome cloned in yeast	C. Tagwerker, C. Dupont, Bogumil J. Karas, Li Ma, R. Chuang, G. A. Benders, A. Ramon, M. Novotny, Michael G. Montague, P. Venepally, D. Brami, Ariel S. Schwartz, C. Andrews-Pfannkoch, D. G. Gibson, J. Glass, Hamilton O. Smith, J. Venter, C. Hutchison	2012	View Paper
A Synthetic Biology Framework for Programming Eukaryotic Transcription Functions	Ahmad S. Khalil, T. Lu, C. Bashor, C. L. Ramirez, Nora C. Pyenson, J. Joung, J. Collins, J. Collins	2012	View Paper
Programmable single-cell mammalian biocomputers	Simon Ausländer, David Ausländer, Marius Müller, Markus Wieland, M. Fussenegger	2012	View Paper
Rational Diversification of a Promoter Providing Fine-Tuned Expression and Orthogonal Regulation for Synthetic Biology	B. A. Blount, Tim Weenink, Serge Vasylechko, T. Ellis	2012	View Paper
A tunable zinc finger-based framework for Boolean logic computation in mammalian cells	J. Lohmueller, Thomas Z. Armel, P. Silver	2012	View Paper
Yeast one-hybrid assays for gene-centered human gene regulatory network mapping	John Reece-Hoyes, A. R. Barutcu, R. McCord, J. Jeong, Lizhi Jiang, A. MacWilliams, Xinping Yang, K. Salehi-Ashtiani, D. Hill, S. Blackshaw, Heng Zhu, J. Dekker, Job Dekker, A. J. Walhout, Albertha J. M. Walhout	2011	View Paper
Enhanced yeast one-hybrid (eY1H) assays for high-throughput gene-centered regulatory network mapping	John Reece-Hoyes, Alos Diallo, B. Lajoie, A. Kent, Shaleen Shrestha, Sreenath Kadreppa, Colin Pesyna, J. Dekker, C. Myers, Albertha J. M. Walhout	2011	View Paper
Synthetic chromosome arms function in yeast and generate phenotypic diversity by design	Jessica S. Dymond, S. Richardson, C. Coombes, Timothy D. Babatz, H. Muller, N. Annaluru, William J. Blake, Joy W. Schwerzmann, Junbiao Dai, D. Lindstrom, Annabel C. Boeke, D. Gottschling, S. Chandrasegaran, J. Bader, J. Boeke	2011	View Paper
Composition and Acidification of the Culture Medium Influences Chronological Aging Similarly in Vineyard and Laboratory Yeast	Christopher J. Murakami, Valerie Z. Wall, Nathan Basisty, M. Kaeberlein	2011	View Paper
Distributed biological computation with multicellular engineered networks	S. Regot, Javier Macía, Núria Conde-Pueyo, Kentaro Furukawa, Jimmy Kjellén, Tom Peeters, S. Hohmann, E. Nadal, F. Posas, R. Solé	2011	View Paper
An auxin-based degron system for the rapid depletion of proteins in nonplant cells	K. Nishimura, T. Fukagawa, H. Takisawa, T. Kakimoto, Masato T. Kanemaki	2009	View Paper
DIVERSITY-BASED, MODEL-GUIDED CONSTRUCTION OF SYNTHETIC GENE NETWORKS WITH PREDICTED FUNCTIONS	T. Ellis, Xiao Wang, J. Collins	2009	View Paper
Refinement and standardization of synthetic biological parts and devices	B. Canton, A. Labno, D. Endy	2008	View Paper
Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome	D. G. Gibson, G. A. Benders, C. Andrews-Pfannkoch, Evgeniya Denisova, Holly Baden-Tillson, J. Zaveri, Timothy B. Stockwell, Anushka Brownley, D. W. Thomas, Mikkel A. Algire, C. Merryman, L. Young, V. Noskov, J. Glass, J. Venter, C. Hutchison, Hamilton O. Smith	2008	View Paper
Disintegrator vectors for single‐copy yeast chromosomal integration	I. Sadowski, Ting-Cheng Su, Jennifer Parent	2007	View Paper
A novel high-throughput (HTP) cloning strategy for site-directed designed chimeragenesis and mutation using the Gateway cloning system	Yasuhiro Suzuki, Naoko Kagawa, Toru Fujino, Tsuyoshi Sumiya, Taichi Andoh, Kumiko Ishikawa, Rie Kimura, Kiyokazu Kemmochi, T. Ohta, Shigeo Tanaka	2005	View Paper
A gateway-compatible yeast one-hybrid system.	B. Deplancke, D. Dupuy, M. Vidal, A. J. Walhout	2004	View Paper
A versatile toolbox for PCR‐based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes	C. Janke, M. Magiera, N. Rathfelder, Christof Taxis, Simone Reber, H. Maekawa, A. Moreno-Borchart, G. Doenges, E. Schwob, E. Schiebel, M. Knop	2004	View Paper
Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae	Mark A. Sheff, K. Thorn	2004	View Paper
Evidence for high specificity and efficiency of multiple recombination signals in mixed DNA cloning by the Multisite Gateway system.	Yukari Sasaki, T. Sone, Shouhei Yoshida, Kazuhide Yahata, Junko Hotta, J. Chesnut, T. Honda, F. Imamoto	2004	View Paper
Engineered gene circuits	J. Hasty, D. McMillen, J. Collins	2002	View Paper
Combinatorial Synthesis of Genetic Networks	C. Guet, M. Elowitz, W. Hsing, S. Leibler	2002	View Paper
Destabilized green fluorescent protein for monitoring dynamic changes in yeast gene expression with flow cytometry	C. Mateus, S. Avery	2000	View Paper
Rapid and reliable protein extraction from yeast	V. Kushnirov	2000	View Paper
Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae	A. L. Goldstein, J. McCusker	1999	View Paper
Evaluation of an autoregulatory tetracycline regulated system	G. Gallia, K. Khalili	1998	View Paper
A Set of Vectors with a Tetracycline‐Regulatable Promoter System for Modulated Gene Expression in Saccharomyces cerevisiae	E. Garí, L. Piedrafita, M. Aldea, E. Herrero	1997	View Paper
Transcriptional activation by tetracyclines in mammalian cells.	M. Gossen, S. Freundlieb, Gabriele Bender, G. Müller, W. Hillen, H. Bujard	1995	View Paper
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.	R. Sikorski, P. Hieter	1989	View Paper
Complete Chemical Synthesis , Assembly , and Cloning of a Mycoplasma genitalium Genome	K. Maeda, Koji Kawabata, P. Mazzali, S. Valenti, K. Nomoto	2008	View Paper
Methods in yeast genetics : a Cold Spring Harbor Laboratory course manual	David C. Amberg, D. Burke, J. Strathern	2005	View Paper
A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications	T. Nagai, K. Ibata, E. S. Park, Mie Kubota, K. Mikoshiba, A. Miyawaki	2002	View Paper
An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.	Gemma B ellí, E. Garí, L. Piedrafita, M. Aldea, E. Herrero	1998	View Paper
Destabilized green ̄ uorescent protein for monitoring dynamic changes in yeast gene expression with ̄ ow cytometry	C. Mateus, S. Avery		View Paper
Nat Methods
Yeast Vectors for Gene Assembly and Expression PLOS ONE \| www.plosone
A DNA fragment containing TetO 2 operator with the TATA region of S. cerevisiae CYC1 gene (CYC1TATA) was amplified from pCM171
TIR1 GGGGACAACTTTTGTATACAAAGTTGTACAAAATGACGTACTTCCCGGAG B1-TIR1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTTAGCTAGTGGATCCGTT PCR primers used in this study. Sequences are in 5 to 3 direction

Gateway vectors for efficient artificial gene assembly in vitro and expression in yeast Saccharomyces cerevisiae

Quick Summary:

Categories:

Key Terms (TF-IDF):

Summary:

Citation & Reference Network Visualization

Citations and References

Similar Papers

Predicting the Evolution of Gene $ura3$ in the Yeast Saccharomyces Cerevisiae

Membrane Trafficking in the Yeast Saccharomyces cerevisiae Model

Evidence for abundant transcription of non-coding regions in the Saccharomyces cerevisiae genome

Evidence for abundant transcription of non-coding regions in the Saccharomyces cerevisiae genome

Comments (0)

Replies (0)

Add a Tag

Confirm Tag Removal

Edit Tag